After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
INSRcDNA Clone Product Information
cDNA Size:4113
cDNA Description:ORF Clone of Homo sapiens insulin receptor transcript variant 2 DNA.
Gene Synonym:HHF5, CD220, INSR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11086-ACG$475
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11086-ACR$475
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11086-CF$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11086-CH$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11086-CM$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11086-CY$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG11086-M$495
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11086-M-F$745
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11086-M-N$745
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11086-NF$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11086-NH$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11086-NM$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11086-NY$445
Human INSR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11086-UT$445
 Learn more about expression Vectors

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
List Price: $445.00  (Save $0.00)
Price:$445.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items