Quick Order

Text Size:AAA

Human TREM2 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human TREM2 cDNA Clone Product Information
NCBI RefSeq:NM_018965.2
RefSeq ORF Size:693bp
cDNA Description:Full length Clone DNA of Homo sapiens triggering receptor expressed on myeloid cells 2 with N terminal Myc tag.
Gene Synonym:TREM-2, Trem2a, Trem2b, Trem2c, TREM2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-TREM2
Restriction Site:KpnI + XbaI (6kb + 0.73kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TREM2 Gene Plasmid Map
Human TREM2 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Triggering receptor expressed on myeloid cells 2 ( TREM2 ) is a single Ig domain receptor. It is expressed on macrophages and dendritic cells but not on granulocytes or monocytes. Its expression is most abundant in the basal ganglia, corpus callosum, medulla oblongata and spinal cord, and microglial cells are the major TREM2-producing cell type in the central nervous system (CNS). TREM2 may play a role in chronic inflammations and may stimulate production of constitutive rather than inflammatory chemokines and cytokines. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. It also associates with the signal adapter protein, DAP12, which has a cytoplasmic ITAM, leading to the subsequent activation of cytoplasmic tyrosine kinases. TREM2 is both required and sufficient for competent uptake of apoptotic neuronal cells. TREM2 and TREM2-L form a receptor-ligand pair connecting microglia with apoptotic neurons, directing removal of damaged cells to allow repair. Deficiency of the adapter protein DAP12 or its associated receptor TREM2 is associated with abnormal osteoclast development in humans. Defects in TREM2 are causes of PLOSL, also known as NHD. In addition, TREM2 signaling is also an important pathway to promote healing of wounds in the colon where stem cell replacement is necessary.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Paloneva, J. et al., 2002, Am. J. Hum. Genet. 71:656-662. 
  • Prada, I. et al., 2006, Neuroscience. 140 (4): 1139-48.
  • Neumann, H. et al., 2007, J Neuroimmunol. 184 (1-2): 92-9.
  • Thrash, JC. et al., 2009, Neurochem Res. 34 (1): 38-45.
  • Size / Price
    Catalog: HG11084-NM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"