Quick Order

Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AKT1S1cDNA Clone Product Information
cDNA Size:771
cDNA Description:ORF Clone of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 DNA.
Gene Synonym:AKT1S1, Lob, PRAS40, MGC2865
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10092-ACG$325
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10092-ACR$325
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10092-ANG$325
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10092-ANR$325
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10092-CF$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10092-CH$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10092-CM$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10092-CY$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10092-M$195
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10092-M-F$395
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10092-M-N$395
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10092-NF$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10092-NH$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10092-NM$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10092-NY$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10092-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items