After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey FLT3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FLT3 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2982bp
cDNA Description:Full length Clone DNA of Macaca mulatta fms-related tyrosine kinase 3 with N terminal His tag.
Gene Synonym:FLT3
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
  • Size / Price
    Catalog: CG90219-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"