After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACE2cDNA Clone Product Information
cDNA Size:2418
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 DNA.
Gene Synonym:ACE2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items