Quick Order

Text Size:AAA

Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPC5cDNA Clone Product Information
Gene_bank_ref_id:NM_004466.3
cDNA Size:1719
cDNA Description:ORF Clone of Homo sapiens glypican 5 DNA.
Gene Synonym:GPC5
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Glypican-5 (GPC5), is a cell membrane protein which belongs to the glypican family. The glypicans compose a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans that may play a role in the control of cell division and growth regulation. So far, six members (Glypican-1/GPC1, Glypican-2/GPC2, Glypican-3/GPC3, Glypican-4/GPC4, Glypican-5/GPC5, Glypican-6/GPC6) of this family are known in vertebrates. In adult, Glypican-5 is primarily expressed in the brain. It is also detected in fetal brain, lung and liver. Glypican-5 enhances the intracellular signaling of FGF2 and HGF. It alters the cellular distribution of FGF2. The properties of Glypican-5 make it an attractive target for therapeutic intervention in rhabdomyosarcomas and other tumors that amplify and/or overexpress its gene. Glypican-5 is over-expressed in lymphoma cell lines that had shown amplification. It is a likely target for amplification, and that over-expression of GPC5 may contribute to development and/or progression of lymphomas and other tumors.

References
  • Yu W, et al. (2003) GPC5 is a possible target for the 13q31-q32 amplification detected in lymphoma cell lines. J Hum Genet. 48(6): 331-5.
  • Williamson D, et al. (2007) Role for amplification and expression of glypican-5 in rhabdomyosarcoma. Cancer Res. 67(1): 57-65.
  • Size / Price
    Catalog:HG10079-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"