After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP8 cDNA Clone Product Information
Gene_bank_ref_id:NM_033355.3
RefSeq ORF Size:1440bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with C terminal His tag.
Gene Synonym:Casp8, CAP4, MACH, MCH5, FLICE, ALPS2B, FLJ17672
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-His tag on other vectors
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-GFPSpark tagHG10078-ACG$325
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10078-ACR$325
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-GFPSpark tagHG10078-ANG$325
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10078-ANR$325
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-Flag tagHG10078-CF$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-His tagHG10078-CH$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-Myc tagHG10078-CM$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, C-HA tagHG10078-CY$295
Human Caspase-8 / ALPS2B transcript variant B Gene cDNA clone plasmidHG10078-M$195
Human Caspase-8 / ALPS2B transcript variant B natural ORF mammalian expression plasmidHG10078-M-N$395
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-Flag tagHG10078-NF$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-His tagHG10078-NH$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-Myc tagHG10078-NM$295
Human Caspase-8 / ALPS2B transcript variant B ORF mammalian expression plasmid, N-HA tagHG10078-NY$295
Human Caspase-8 / ALPS2B transcript variant B natural ORF mammalian expression plasmidHG10078-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10078-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"