Quick Order

Human PARP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PARP1cDNA Clone Product Information
cDNA Size:3045
cDNA Description:ORF Clone of Homo sapiens poly (ADP-ribose) polymerase 1 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.

  • Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.
  • Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.
  • Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.
  • Ahell I. et al., 2008, Nature. 451: 81-85.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items