Quick Order

Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD14cDNA Clone Product Information
Gene_bank_ref_id:NM_000591.2
cDNA Size:1128
cDNA Description:ORF Clone of Homo sapiens CD14 molecule, transcript variant 1 DNA.
Gene Synonym:CD14
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10073-ACG$325
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10073-ACR$325
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10073-CF$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10073-CH$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10073-CM$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10073-CY$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10073-M$95
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10073-M-F$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10073-M-N$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10073-NF$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10073-NH$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10073-NM$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10073-NY$295
Human CD14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10073-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 14 (CD14) is a member of the CD system. It takes its name from its inclusion in the CD molecule surface marker proteins. CD14 exists in two forms: a form anchored into the membrane or a soluble form. CD14 was found expressed in macrophages, neutrophil granulocyte and dendritic cells. The major function is serve as a co-receptor (along with TLR4 and MD-2) for the bacterial lipopolysaccharide (LPS) and other pathogen-associated molecular patterns.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • SD Wright, et al. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 249 (4975): 1431-3.
  • Size / Price
    Catalog:HG10073-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"