Quick Order

Text Size:AAA

Human CHST15 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHST15cDNA Clone Product Information
Gene_bank_ref_id:NM_015892.2
cDNA Size:1686
cDNA Description:ORF Clone of Homo sapiens carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 DNA.
Gene Synonym:KIAA0598, MGC34346, RP11-47G11.1, DKFZp781H1369
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.

Size / Price
Catalog:HG11033-NM
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"