After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA8cDNA Clone Product Information
Gene_bank_ref_id:NM_004056.4
cDNA Size:873
cDNA Description:ORF Clone of Homo sapiens carbonic anhydrase VIII DNA.
Gene Synonym:CA8, CALS, CARP, CA-VIII
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10063-ACG$325
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10063-ACR$325
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10063-ANG$325
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10063-ANR$325
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10063-CF$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10063-CH$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10063-CM$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10063-CY$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone)HG10063-M$95
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10063-M-F$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10063-M-N$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10063-NF$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10063-NH$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10063-NM$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10063-NY$295
Human CA VIII Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10063-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase protein (CA) VIII, which is a member of the CA gene family, has been shown to have no catalytic CA activity and its biological function is still unknown. Increased expression of CA-RP VIII was observed in 78% of colorectal carcinomas. It suggested that CA-RP VIII plays a role in the process of invasion in colorectal cancer.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Miyaji E, et al. (2003) Overexpression of carbonic anhydrase-related protein VIII in human colorectal cancer. The Journal of Pathology. 201(1): 37-45.
  • Size / Price
    Catalog:HG10063-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"