Quick Order

Human Caspase-2 transcript variant 1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_032982.2
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 1 with C terminal His tag.
Gene Synonym:CASP2, ICH1, NEDD2, CASP-2, ICH-1L, ICH-1L/1S
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human Caspase-2 transcript variant 1 ORF mammalian expression plasmid, C-His tag on other vectors
Product nameProduct name
Size / Price
Catalog: HG10055-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"