Quick Order

Text Size:AAA

Human SERPINI2 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human SERPINI2 cDNA Clone Product Information
NCBI RefSeq:NM_006217.3
RefSeq ORF Size:1218bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade I (pancpin), member 2 with N terminal Myc tag.
Gene Synonym:MEPI, PI14PANCPIN, TSA2004
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Serpin-I2, also known as myoepithelium-derived serine protease inhibitor, Pancreas-specific protein TSA2004, Peptidase inhibitor 14, PI14, SERPINI2 and MEPI, is a secreted protein which belongs to the serpin family. It is expressed in pancreas and adipose tissues. SERPINI2 deficiency directly results in the acinar cell apoptosis and malabsorption.

References
  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Loftus,S.K. et al., 2005, PLoS Genet. 1 (3):e38.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • Size / Price
    Catalog: HG11008-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"