Quick Order

Human MSLN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MSLNcDNA Clone Product Information
cDNA Size:1869
cDNA Description:ORF Clone of Homo sapiens mesothelin DNA.
Gene Synonym:MPF, SMRP, MSLN
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Megakaryocyte potentiating factor belongs to the mesothelin family. This family is comprised by several mammalian pre-pro-megakaryocyte potentiating factor precursor (MPF) or mesothelin proteins. Mesothelin is a glycosylphosphatidylinositol-linked glycoprotein highly expressed in mesothelial cells, mesotheliomas, and ovarian cancer, but the biological function of the protein is not known. Megakaryocyte potentiating factor is highly expressed in mesotheliomas, ovarian cancers, and some squamous cell carcinomas (at protein level). It interacts with MUC16 and potentiates megakaryocyte colony formation in vitro. Megakaryocyte potentiating factor is secreted by several mesothelioma cell lines and is frequently elevated in the blood of patients with mesothelioma. Measurement of this protein may be useful in following the response of mesothelioma to treatment.

  • Chang MC, et al. (2012) Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442 (2): 293-302.
  • Nelson HH, et al. (2011) The relationship between tumor MSLN methylation and serum mesothelin (SMRP) in mesothelioma. Epigenetics. 6 (8): 1029-34.
  • Bournet B, et al. (2012) Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples. Pancreatology. 12 (1): 27-34.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items