After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey CD1B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD1BcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1002
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD1b molecule DNA.
Gene Synonym:CD1B
Species:Cynomolgus
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

References
  • Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.
  • Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.
  • Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.
  • Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.
  • Size / Price
    Catalog:CG90173-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"