Quick Order

Text Size:AAA

Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LGALS8cDNA Clone Product Information
cDNA Size:954
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) lectin, galactoside-binding, soluble, 8 DNA.
Gene Synonym:LGALS8
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90167-ACG$325
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90167-ACR$325
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90167-ANG$325
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90167-ANR$325
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90167-CF$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90167-CH$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90167-CM$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90167-CY$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone)CG90167-G$95
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90167-NF$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90167-NH$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90167-NM$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90167-NY$295
Cynomolgus monkey LGALS8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90167-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks