Quick Order

Human SERPINA6 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINA6 cDNA Clone Product Information
NCBI RefSeq:NM_001756.3
RefSeq ORF Size:1218bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 with N terminal Myc tag.
Gene Synonym:CBG,
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Corticosteroid-binding globulin (CBG), also known as SerpinA6, is a non-inhibitory member of the serine proteinase inhibitor (serpin) superfamily. It is the high-affinity transport protein for glucocorticoids in vertebrate blood. CBG is specifically cleaved by this protease at a precise site close to its carboxy-terminus. This induces a conformation change and disrupts the binding between glucocorticoids and CBG, and promotes a significant and local release of glucocorticoids (over 90% of them are bound to CBG in human plasma). In this context, CBG directs glucocorticoids to sites of inflammation, and plays in consequence a crucial role in efficient glucocorticoid action in physiology. The SerpinA6 protein is mainly secreted by the liver. This negative acute phase protein regulates free cortisol levels in the blood and distributes cortisol to its target tissues. SerpinA6 deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo-/hypertension and muscle fatigue. There are three heritable, human CBG gene mutations that can reduce CBG-cortisol binding affinity and/or reduce circulating CBG levels.

References
  • Seralini GE. (1991) A new role for corticosteroid binding globulin (CBG), member of SERPIN superfamily. C R Seances Soc Biol Fil. 185(6): 500-9.
  • Buss C, et al. (2007) Haploinsufficiency of the SERPINA6 gene is associated with severe muscle fatigue: A de novo mutation in corticosteroid-binding globulin deficiency. J Neural Transm. 114(5): 563-9.
  • Torpy DJ, et al. (2007) Corticosteroid-binding globulin gene polymorphisms: clinical implications and links to idiopathic chronic fatigue disorders. Clin Endocrinol (Oxf). 67(2): 161-7.
  • Braun BC, et al. (2010) Effect of mutations of the human serpin protein corticosteroid-binding globulin on cortisol-binding, thermal and protease sensitivity. J Steroid Biochem Mol Biol. 120(1): 30-7.
  • Lin HY, et al. (2010) Molecular and structural basis of steroid hormone binding and release from corticosteroid-binding globulin. Mol Cell Endocrinol. 316(1): 3-12.
  • Size / Price
    Catalog: HG10998-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"