Quick Order

Text Size:AAA

Human protein kinase C, alpha ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKCA cDNA Clone Product Information
Gene_bank_ref_id:NM_002737.2
RefSeq ORF Size:2019bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase C, alpha with C terminal His tag.
Gene Synonym:PRKCA, PKCα, AAG6, PKCA, PRKACA
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-PRKCA-His
Restriction Site:KpnI + XbaI (6kb + 2.06kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRKCA Gene Plasmid Map
Human protein kinase C, alpha ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG10026-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"