Quick Order

Cynomolgus monkey FCN1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FCN1 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:981bp
cDNA Description:Full length Clone DNA of Macaca mulatta ficolin (collagen/fibrinogen domain containing) 1 with N terminal His tag.
Gene Synonym:FCN1
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

References
  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Size / Price
    Catalog: CG90154-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"