After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TSPAN1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TSPAN1 cDNA Clone Product Information
NCBI RefSeq:NM_005727.3
RefSeq ORF Size:726bp
cDNA Description:Full length Clone DNA of Homo sapiens tetraspanin 1 with C terminal Myc tag.
Gene Synonym:NET1, TM4C, TM4SF, TSPAN1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

TSPAN1 belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins have four hydrophobic domains, intracellular N- and C-termini and two extracellular domains. Tetraspanins act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane. They also mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN1 interacts with human thiamine transporter-1 (hTHTR-1). HTHTR-1 contributes to intestinal thiamine uptake, and its function is regulated at both the transcriptional and posttranscriptional levels. TSPAN1 and hTHTR-1 colocalize in human intestinal epithelial HuTu-80 cells. Coexpression of TSPAN1 in these cells led to a significant decrease in the rate of degradation of hTHTR-1 compared with cells expressing the hTHTR-1 alone; in fact the half-life of the TSPAN1 protein was twice longer in the former cell type compared with the latter cell type.

References
  • Chen L. et al., 2010, J Korean Med Sci. 25 (10): 1438-42.
  • Chen L. et al., 2010, Tumori. 96 (5): 744-50.
  • Nabokina SM. et al., 2011, Am J Physiol Gastrointest Liver Physiol. 301 (5): G808-13.
  • Size / Price
    Catalog: HG13073-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"