Quick Order

Text Size:AAA

Cynomolgus monkey IFNAR1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IFNAR1 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1677bp
cDNA Description:Full length Clone DNA of Macaca mulatta interferon (alpha, beta and omega) receptor 1 with N terminal His tag.
Gene Synonym:IFNAR1
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinRhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human IFNA4 Protein (His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Rhesus IFNG / Interferon Gamma ProteinHuman IL-28B / IFN-lambda-3 Protein (His Tag)Human IFN-alpha / IFNA1 / IFN Protein (His Tag)Human Interferon alpha-B / IFNA8 Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNGR2 Protein (His Tag)Mouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human Interferon alpha 10 / IFNA10 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Rat IFNA5 / IFNaG Protein (His Tag)Human Interferon beta / IFN-beta / IFNB ProteinCynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinCynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinCynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Human Interferon alpha-B / IFNA8 ProteinFerret IFNG / Interferon Gamma Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)Rhesus IFNAR1 / IFNAR ProteinRhesus IFN gamma Protein (His Tag)
Background

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

References
  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    Catalog: CG90113-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"