Quick Order

Text Size:AAA

Ferret UBE2L6 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret UBE2L6 cDNA Clone Product Information
Gene_bank_ref_id:XM_004777586.1
RefSeq ORF Size:462bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) ubiquitin-conjugating enzyme E2L 6 with C terminal His tag.
Gene Synonym:UBE2L6
Species:Ferret
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

UBCH8, also known as UBE2L6, belongs to the ubiquitin-conjugating enzyme family. The family of ubiquitin-conjugating (E2) enzymes is characterized by the presence of a highly conserved ubiquitin-conjugating (UBC) domain. These domains accommodate the ATP-activated ubiquitin (Ub) or ubiquitin-like (UBL) protein via a covalently linked thioester onto its active-site residue. E2 enzymes act via selective protein-protein interactions with the E1 and E3 enzymes and connect activation to covalent modification. By doing so, E2s differentiate effects on downstream substrates, either with a single Ub/UBL molecule or as a chain. UBCH8 is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. It catalyzes the covalent attachment of ubiquitin or ISG15 to other proteins. UBCH8 functions in the E6/E6-AP-induced ubiquitination of p53/TP53 and promotes ubiquitination and subsequent proteasomal degradation of FLT3. At protein level, it is present in natural killer cells.

References
  • Moynihan TP, et al. (1999) The ubiquitin-conjugating enzymes UbcH7 and UbcH8 interact with RING finger/IBR motif-containing domains of HHARI and H7-AP1. J Biol Chem. 274(43):30963-8.
  • Ardley HC, et al. (2000) Genomic organization of the human ubiquitin-conjugating enzyme gene, UBE2L6 on chromosome 11q12. Cytogenet Cell Genet. 89(1-2):137-40.
  • Zhao C, et al. (2004) The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad. 101(20):7578-82.
  • Tripathi MK, et al. (2005) Down-regulation of UCRP and UBE2L6 in BRCA2 knocked-down human breast cells. Biochem Biophys Res Commun. 328(1):43-8.
  • Size / Price
    Catalog: FG60136-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"