Quick Order

Human CLEC3B ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC3B cDNA Clone Product Information
Gene_bank_ref_id:BC011024.1
RefSeq ORF Size:609bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 3, member B with C terminal Myc tag.
Gene Synonym:TN, TNA, DKFZp686H17246, CLEC3B
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

References
  • Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.
  • Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.
  • Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.
  • Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.
  • Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.
  • Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.
  • Size / Price
    Catalog: HG12735-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"