Quick Order

Text Size:AAA

Human PDK1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDK1 cDNA Clone Product Information
Gene_bank_ref_id:BC039158
RefSeq ORF Size:1311bp
cDNA Description:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 with C terminal Myc tag.
Gene Synonym:PDK1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-PDK1-Myc
Restriction Site:KpnI + XbaI (6kb + 1.36kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PDK1 Gene Plasmid Map
Human PDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

References
  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    Catalog: HG12312-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"