After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey IGFBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGFBP1cDNA Clone Product Information
cDNA Size:846
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) insulin-like growth factor binding protein 1 DNA.
Gene Synonym:IGFBP1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.


IGFBP1, also known as IGFBP-1 and insulin-like growth factor-binding protein 1, is a member of the insulin-like growth factor binding protein family. IGF binding proteins (IGFBPs) are proteins of 24 to 45 kDa. All six IGFBPs share 50% homology with each other and have binding affinities for IGF-I and IGF-II at the same order of magnitude as the ligands have for the IGF-IR. IGF-binding proteins prolong the half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture. They alter the interaction of IGFs with their cell surface receptors. IGFBP1 has an IGFBP domain and a thyroglobulin type-I domain. It binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors.

  • Wood AW, et al. (2005) Insulin-like growth factor signaling in fish. Int Rev Cytol. 243:215-85.
  • Firth SM, et al. (2003) Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23 (6):824-54.
  • Ferry RJ, et al. (1999) Insulin-like growth factor binding proteins: new proteins, new functions. Horm Res. 51(2):53-67.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items