Quick Order

Text Size:AAA

Cynomolgus monkey IGFBP3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGFBP3cDNA Clone Product Information
cDNA Size:876
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) insulin-like growth factor binding protein 3 DNA.
Gene Synonym:IGFBP3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.


The Insulin-like Growth Factor (IGF) signaling system plays a central role in cellular growth, differentiation and proliferation. IGFBP3 is the most abundant IGF binding protein in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms. It appears to function both by cell cycle blockade and the induction of apoptosis. IGFBP3 can be transported to the nucleus by an importin beta mediated mechanism, where it has been shown to interact with the retinoid X receptor alpha and possibly other nuclear elements. IGFBP3 antiproliferative signalling appears to require an active transforming growth factor beta (TGF-beta) signalling pathway, and IGFBP3 stimulates phosphorylation of the TGF-beta signalling intermediates Smad2 and Smad3. IGFBP3 has IGF-independent roles in inhibiting cell proliferation in cancer cell lines. Nuclear transcription factor, retinoid X receptor (RXR)-alpha, and IGFBP3 functionally interact to reduce prostate tumor growth and prostate-specific antigen in vivo. Several clinical studies have proposed that individuals with IGFBP3 levels in the upper range of normal may have a decreased risk for certain common cancers. This includes evidence of a protective effect against breast cancer, prostate cancer, colorectal cancer, and lung cancer. Moreover, IGFBP3 inhibits insulin-stimulated glucose uptake into adipocytes independent of IGF.

  • Baxter RC. (2001) Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol. 54(3): 145-8.
  • Butt AJ, et al. (2001) IGFBP-3 and apoptosis--a license to kill? Apoptosis. 6(3): 199-205.
  • Ali O, et al. (2003) Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35(11-12): 726-33.
  • Yamada PM, et al. (2009) Perspectives in mammalian IGFBP-3 biology: local vs. systemic action. Am J Physiol Cell Physiol. 296(5): C954-76.