After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCL15 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL15cDNA Clone Product Information
Gene_bank_ref_id:NM_004167.3
cDNA Size:342
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 15 DNA.
Gene Synonym:LKN1, NCC3, SY15, HCC-2, Lkn-1, MIP-5, NCC-3, SCYL3, MIP-1d, SCYA15, HMRP-2B
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Chemokine & Receptor Related Products
Product nameProduct name
Background

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 15 (CCL15), also known as leukotactin-1, MIP5, MIP1 and HCC-2, is a small cytokine belonging to the C-C chemokine family. CCL15 is prevantly expressed in liver, small intestine, colon, and in certain leukocytes and macrophages of the lung. It is chemotactic for neutrophils, monocytes, and lymphocytes and elicits its effects by binding to cell surface chemokine receptors like CCR1 and CCR3.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Youn, et al. (1997) Molecular cloning of leukotactin-1: a novel human beta-chemokine, a chemoattractant for neutrophils, monocytes, and lymphocytes, and a potent agonist at CC chemokine receptors 1 and 3. J Immun. 159: 5201-5.
  • Coulin, et al. (1997) Characterization of macrophage inflammatory protein-5 / human CC cytokine-2, a member of the macrophage-inflammatory-protein family of chemokines. Europ J Biochem. 248: 507-15.
  •  

    CCL15/MIP-5/MIP-1 delta related areas, pathways, and other information

    Size / Price
    Catalog:HG10898-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"