After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human ADAM12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADAM12cDNA Clone Product Information
cDNA Size:2721
cDNA Description:ORF Clone of Homo sapiens ADAM metallopeptidase domain 12, transcript variant 1 DNA.
Gene Synonym:RP11-295J3.5, MCMP, MCMPMltna, MLTN, MLTNA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ADAM12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

The ADAMs (a disintegrin and metalloprotease) comprise a family of multidomain proteins with metalloprotease, cell adhesion, and signaling activities. Human ADAM12, which is implicated in diseases such as cancer, is expressed in two splice forms, the transmembrane ADAM12-L and the shorter and soluble ADAM12-S. ADAM12, also known as and Meltrin alpha, is a member of the ADAM protein family, which contains one disintegrin domain, one EGF-like domain and one peptidase M12B domain. ADAM12 is synthesized as a zymogen with the prodomain keeping the metalloprotease inactive through a cysteine-switch mechanism. Maturation and activation of the protease involves the cleavage of the prodomain in the trans-Golgi or possibly at the cell surface by a furin-peptidase. It is a membrane-anchored metalloprotease, which has been implicated in activation-inactivation of growth factors that play an important role in wound healing, including heparin-binding epidermal growth factor (EGF)-like growth factor (HB-EGF) and IGF binding proteins. ADAM12 may also regulate cell-cell and cell-extracellular matrix contacts through interactions with cell surface receptors - integrins and syndecans - potentially influencing the actin cytoskeleton. Moreover, ADAM12 interacts with several cytoplasmic signaling and adaptor molecules through its intracellular domain, thereby directly transmitting signals to or from the cell interior. These ADAM12-mediated cellular effects appear to be critical events in both biological and pathological processes. In addition to protease activity, ADAM12 possesses cell binding and cell signaling properties. In many studies, ADAM12 overexpression has been correlated with disease, and ADAM12 has been shown to promote tumor growth and progression in cancer. On the other hand, protective effects of ADAM12 in disease have also been reported.

  • Wewer UM, et al. (2006) ADAM12 is a four-leafed clover: the excised prodomain remains bound to the mature enzyme. J Biol Chem. 281(14): 9418-22.
  • Kveiborg M, et al. (2008) Cellular roles of ADAM12 in health and disease. Int J Biochem Cell Biol. 40(9): 1685-702.
  • Harsha A, et al. (2008) ADAM12: a potential target for the treatment of chronic wounds. J Mol Med. 86(8): 961-9.
  • Jacobsen J, et al. (2009) Targeting ADAM12 in human disease: head, body or tail? Curr Pharm Des. 15(20): 2300-10.
  • Baertling F, et al. (2010) ADAM12 is expressed by astrocytes during experimental demyelination. Brain Res. 1326: 1-14.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items