After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey ACVRL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACVRL1cDNA Clone Product Information
cDNA Size:1512
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) activin A receptor type II-like 1 DNA.
Gene Synonym:ACVRL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items