After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CLIC4 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLIC4 cDNA Clone Product Information
Gene_bank_ref_id:BC012444
RefSeq ORF Size:762bp
cDNA Description:Full length Clone DNA of Homo sapiens chloride intracellular channel 4 with C terminal Myc tag.
Gene Synonym:H1, huH1, p64H1, CLIC4L, MTCLIC, CLIC4
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Chloride intracellular channel protein 4, also known as Intracellular chloride ion channel protein p64H1 and CLIC4, is a member of the chloride channel CLIC family. It contains one GST C-terminal domain. CLIC4 is a member of a family of intracellular chloride channels. It is regulated by p53, c-Myc, and tumor necrosis factor-alpha. CLIC4 is detected in epithelial cells from colon, esophagus and kidney (at protein level). CLIC4 has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. CLIC4 could promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis). Expression of CLIC4 is prominent in heart, kidney, placenta and skeletal muscle. Overexpression of CLIC4 in cancer cells inhibits tumor growth. Conversely, overexpression of CLIC4 in tumor stromal cells stimulates tumor growth. Thus, CLIC4 participates in normal and pathological processes and may serve as a useful target for therapies in disturbances of homeostasis and neoplastic transformation. Loss of CLIC4 in tumor cells and gain in tumor stroma is common to many human cancers and marks malignant progression. Up-regulation of CLIC4 in tumor stroma is coincident with myofibroblast conversion, generally a poor prognostic indicator. Reactivation and restoration of CLIC4 in tumor cells or the converse in tumor stromal cells could provide a novel approach to inhibit tumor growth.

References
  • Ronnov-Jessen L., et al., 2002, Am. J. Pathol. 161:471-480.
  • Berryman M.A., et al., 2003, Cell Motil. Cytoskeleton 56:159-172.
  • Suh,K.S. et al., 2005, J Investig Dermatol Symp Proc. 10 (2):105-9.
  • Suh,K.S. et al., 2007, Mol Carcinog.46 (8):599-604.
  • Suh,K.S. et al., 2007, J Cell Sci  120 (Pt 15):2631-40.
  • Suh,K.S. et al., 2007, Clin Cancer Res  13 (1):121-31.
  • Size / Price
    Catalog: HG12271-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"