Quick Order

Human IL24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL24cDNA Clone Product Information
cDNA Size:624
cDNA Description:ORF Clone of Homo sapiens interleukin 24 DNA.
Gene Synonym:C49A, FISP, MDA7, MOB5, ST16, IL10B, IL24
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-10 Family & Receptor Related Products

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.