Quick Order

Human SRPK1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SRPK1 cDNA Clone Product Information
Gene_bank_ref_id:BC038292
RefSeq ORF Size:1968bp
cDNA Description:Full length Clone DNA of Homo sapiens SFRS protein kinase 1 with C terminal Myc tag.
Gene Synonym:SFRSK1, SRPK1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serine / threonine-protein kinase SRPK1, also known as SFRS protein kinase 1, Serine/arginine-rich protein-specific kinase 1, SR-protein-specific kinase 1 and SRPK1, is a cytoplasm and nucleus protein which belongs to the protein kinase superfamily and CMGC Ser/Thr protein kinase family. Isoform 2 of SRPK1 is predominantly expressed in the testis but is also present at lower levels in heart, ovary, small intestine, liver, kidney, pancreas and skeletal muscle. Isoform 1 of SRPK1 is only seen in the testis, at lower levels than isoform 2. SRPK1 hyperphosphorylates RS domain-containing proteins such as SFRS1, SFRS2 and ZRSR2 on serine residues during metaphase but at lower levels during interphase. SRPK1 plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. SRPK1 locks onto SFRS1 to form a stable complex and processively phosphorylates the RS domain. SRPK1 appears to mediate HBV core protein phosphorylation which is a prerequisite for pregenomic RNA encapsidation into viral capsids.

References
  • Ngo J.C.K. et al., 2005, Mol. Cell 20:77-89.
  • Krishnakumar,S. et al., 2008, Pediatr Blood Cancer 50 (2):402-6.
  • Ma,C.T. et al., 2009, J Mol Biol  390 (4):618-34.
  • Souki S.K. et al., 2009, J. Virol. 83:8970-8975.
  • Choudhary C. et al., 2009, Science 325:834-840. 
  • Size / Price
    Catalog: HG12249-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"