Quick Order

Human GPR114 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPR114cDNA Clone Product Information
Gene_bank_ref_id:NM_153837.1
cDNA Size:1587
cDNA Description:ORF Clone of Homo sapiens G protein-coupled receptor 114 DNA.
Gene Synonym:PGR27, GPR114
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

GPR114 belongs to the G-protein coupled receptor 2 family. Members of this family share a common molecular architecture which consists of seven transmembrane domains, three extracellular loops, three intracellular loops, an amino-terminal extracellular domain and an intracellular carboxyl terminus. It is thought that light acts as the activating stimulus of a G-protein-coupled receptor (GPCR). GPCRs are expected to have molecular function (G-protein coupled receptor activity) and to localize in various compartments (endoplasmic reticulum membrane, plasma membrane, integral to membrane). Family B of the GPCRs is a small but structurally and functionally diverse group of proteins that includes receptors for polypeptide hormones, molecules thought to mediate intercellular interactions at the plasma membrane and a group of Drosophila proteins that regulate stress responses and longevity. GPR114 contains 1 GPS domain. GPR114 gene has been proposed to participate in processes (G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway).

References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Bjarnadttir TK, et al. (2005) The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. Genomics. 84(1):23-33.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog:HG10854-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"