Quick Order

Human PVRL3 / PRR3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PVRL3 cDNA Clone Product Information
Gene_bank_ref_id:NM_015480.1
RefSeq ORF Size:1566bp
cDNA Description:Full length Clone DNA of Homo sapiens poliovirus receptor-related 3 with N terminal Myc tag.
Gene Synonym:PPR3, PRR3, CD113, PVRR3, CDw113, FLJ90624, nectin-3, DKFZp566B0846, PVRL3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-PVRL3
Restriction Site:KpnI + XbaI (6kb + 1.57kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PVRL3 Gene Plasmid Map
Human PVRL3 / PRR3 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Poliovirus receptor-related 3 (PVRL3), also known as Nectin-3 and CD113, is a member of the nectin family. PVRL3/Nectin-3 is an 83 kDa, type I transmembrane glycoprotein. Its precursor is 549 amino acids (aa) in length and contains an extended signal sequence of 57 aa, an extracellular domain (ECD) of 347 aa, a transmembrane segment of 21 aa, and a cytoplasmic region of 124 aa. Nectin-3 has three splicing variants, nectin-3alpha (biggest), -3beta (middle), and -3gamma (smallest). It is predominantly expressed in testis and placenta as well as in various cell lines, including epithelial cell lines. PVRL3/Nectin-3 plays a role in cell-cell adhesion through heterophilic trans-interactions with nectin-like proteins or nectins, such as trans-interaction with PVRL2/Nectin-2 at Sertoli-spermatid junctions. PVRL3/Nectin-3 is thus involved in the formation of cell-cell junctions, including adherens junctions and synapses. It has been shown to induce endocytosis-mediated down-regulation of PVR from the cell surface, resulting in reduction of cell movement and proliferation.

References
  • Satoh-Horikawa, et al. (2000). Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem (UNITED STATES) . 275 (14): 10291-9.
  • Reymond N, et al. (2000). Human nectin3/PRR3: a novel member of the PVR/PRR/nectin family that interacts with afadin. Gene (NETHERLANDS). 255 (2): 347-55.
  • Size / Price
    Catalog: HG10852-NM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"