After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey IFNG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNGcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:498
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interferon-gamma DNA.
Gene Synonym:IFN-gamma, IFNG
Species:Cynomolgus
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Interferon & Receptor Related Products
Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinCynomolgus IFNAR1 / IFNAR ProteinCynomolgus / Rhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus / Rhesus IFNG / Interferon Gamma ProteinHuman IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon alpha-B / IFNA8 ProteinHuman Interferon alpha 10 / IFNA10 Protein (Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB ProteinHuman Interferon alpha-B / IFNA8 Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinMouse IFNGR2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinMouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Cynomolgus / Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Ferret IFNG / Interferon Gamma Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Rat IFNA5 / IFNaG Protein (His Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (His Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNAR1 / IFNAR Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Cynomolgus IFN gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Cynomolgus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Cynomolgus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)
Background

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

References
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catalog:CG90008-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"