After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human DEFB103A ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DEFB103A cDNA Clone Product Information
Gene_bank_ref_id:NM_018661.3
RefSeq ORF Size:204bp
cDNA Description:Full length Clone DNA of Homo sapiens defensin, beta 103A with N terminal Myc tag.
Gene Synonym:DEFB103A
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and cytotoxic peptides made by neutrophils. Members of the beta-defensin 3 family are highly similar in protein sequence. Beta-defensin 3 shows antimicrobial activity against Gram-positive bacteria S.aureus and S.pyogenes, Gram-negative bacteria P.aeruginosa and E.coli and the yeast C.albicans. Beta-defensin 3 is abundantly expressed in skin and tonsils, and to a lesser extent in trachea, uterus, kidney, thymus, adenoid, pharynx and tongue. It is also expressed in salivary gland, bone marrow, colon, stomach, polyp and larynx. However, in small intestine, it cannot be detected. Defensin has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. Beta-defensin 3 kills multiresistant S.aureus and vancomycin-resistent E.faecium. It has no significant hemolytic activity.

References
  • Garca JR, et al. (2002) Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306(2):257-64.
  • Dunsche A, et al. (2002) The novel human beta-defensin-3 is widely expressed in oral tissues. Eur J Oral Sci. 110(2):121-4.
  • Abiko Y, et al. (2004) Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci. 31(3): 225-8.
  • Size / Price
    Catalog: HG10849-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"