After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLAMF1cDNA Clone Product Information
Gene_bank_ref_id:NM_003037.2
cDNA Size:1008
cDNA Description:ORF Clone of Homo sapiens signaling lymphocytic activation molecule family member 1 DNA.
Gene Synonym:SLAM, CD150, CDw150, SLAMF1
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.

References
  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.
  • Size / Price
    Catalog:HG10837-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"