Quick Order

Human FES Kinase / Feline sarcoma oncogene ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FES cDNA Clone Product Information
Gene_bank_ref_id:BC035357
RefSeq ORF Size:2469bp
cDNA Description:Full length Clone DNA of Homo sapiens feline sarcoma oncogene with C terminal Myc tag.
Gene Synonym:FPS, FES
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human FES Kinase / Feline sarcoma oncogene ORF mammalian expression plasmid, C-Myc tag on other vectors
Product nameProduct name
Background

Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and FPS, is a protein which contains one FCH domain, one protein kinase domain and one SH2 domain. FES is a non-receptor protein tyrosine kinase expressed in hematopoietic progenitors and differentiated myeloid cells. FES is observed in the nuclear, granular and plasma membrane fractions of primary human neutrophils and the myeloid leukemia cell line, HL-60. The nuclear localization is confirmed by immunocytochemistry of neutrophils. FES has been implicated in granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3) and erythropoietin signal transduction. FES has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. FES is also involved in normal hematopoiesis. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia.

References
  • Bowden DW, et al.,1991, Nucleic acids Res 19 (15): 4311.
  • Yates,K.E. et al., 1995, Oncogene. 10 (6):1239-42.
  • Jücker, M, et al.,1997, J. Biol. Chem.  272 (4): 2104-9.
  • Smithgall,T.E. et al., 1998, Crit Rev Oncog. 9 (1):43-62.
  • Lionberger, et al.,2000, Cancer Res. 60 (4): 1097-103.
  • Size / Price
    Catalog: HG12214-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"