Quick Order

Text Size:AAA

Human P4HB / DSI ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human P4HB cDNA Clone Product Information
Gene_bank_ref_id:NM_000918.3
RefSeq ORF Size:1527bp
cDNA Description:Full length Clone DNA of Homo sapiens procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide with N terminal Myc tag.
Gene Synonym:DSI, GIT, PDI, PHDB, PDIA1, PO4DB, PO4HB, PROHB, ERBA2L, P4HB
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse protein disulfide-isomerase, also known as Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55 and P4HB, is a peripheral membrane protein which belongs to the protein disulfide isomerase family. P4HB is highly abundant. In some cell types, it seems to be also secreted or associated with the plasma membrane, where it undergoes constant shedding and replacement from intracellular sources. P4HB localizes near CD4-enriched regions on lymphoid cell surfaces. It is identified by mass spectrometry in melanosome fractions from stage I to stage IV. P4HB reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell. P4HB catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, it seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. P4HB may therefore cause structural modifications of exofacial proteins. Inside the cell, it seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, P4HB functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, it facilitates aggregation (anti-chaperone activity). P4HB may be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. It also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP.

References
  • Kivirikko KI, et al., 1989, FASEB J., 3 (5): 1609-17.
  • Pihlajaniemi T, et al.,1991, J Hepatol., 13, Suppl 3: S2
  • Fenouillet E., et al., 2001, J. Infect. Dis. 183:744-752.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Barbouche R., et al., 2003, J. Biol. Chem. 278:3131-3136.
  • Size / Price
    Catalog: HG10827-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"