Quick Order

Text Size:AAA

Human OMD Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OMDcDNA Clone Product Information
Gene_bank_ref_id:NM_005014.2
cDNA Size:1266
cDNA Description:ORF Clone of Homo sapiens osteomodulin DNA.
Gene Synonym:OSAD, SLRR2C, OMD
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

References
  • Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.
  • Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.
  • Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"