Quick Order

Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEACAM6cDNA Clone Product Information
cDNA Size:1035
cDNA Description:ORF Clone of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) DNA.
Gene Synonym:NCA, CEAL, CD66c, CEACAM6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10823-ACG$325
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10823-ACR$325
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10823-CF$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10823-CH$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10823-CM$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10823-CY$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone)HG10823-M$95
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10823-M-F$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10823-M-N$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10823-NF$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10823-NH$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10823-NM$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10823-NY$295
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10823-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is one of seven human CEACAM family members within the immunoglobulin superfamily. It s a glycosylphosphatidylinositol-linked immunoglobulin superfamily member that is overexpressed in a variety of human cancers, including colon, breast and lung and is associated with tumourigenesis, tumour cell adhesion, invasion and metastasis. CEACAM6 is a unique mediator of migration and invasion of drug resistant oestrogen-deprived breast cancer cells, and this protein could be an important biomarker of metastasis. CEACAM6 is expressed by granulocytes and their progenitors. It is also expressed by epithelia of various organs and is upregulated in pancreatic and colon adenocarcinomas, as well as hyperplastic polyps. Resistance to adhesion-related apoptosis in tumor cells is conferred in the condition of CEACAM6 overexpression.

  • Duxbury MS, et al. (2004) Overexpression of CEACAM6 promotes insulin-like growth factor I-induced pancreatic adenocarcinoma cellular invasiveness. Oncogene. 23(34): 5834-42.
  • Lewis-Wambi JS, et al. (2008) Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44(12): 1770-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items