After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Canine ST6GAL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ST6GAL1cDNA Clone Product Information
cDNA Size:1200
cDNA Description:ORF Clone of Canis lupus familiaris ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 DNA.
Gene Synonym:ST6GAL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items