After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STK16 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human STK16 cDNA Clone Product Information
Gene_bank_ref_id:BC002618
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine kinase 16 with C terminal Myc tag.
Gene Synonym:KRCT, MPSK, TSF1, PKL12, STK16
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serine/threonine-protein kinase 16, also known as myristoylated and palmitoylated serine/threonine-protein kinase, Protein kinase PKL12, TGF-beta-stimulated factor 1, TSF-1, MPSK1 and STK16, is a membrane protein which is ubiquitously expressed at very low levels. STK16 / MPSK1 belongs to the protein kinase superfamily and Ser/Thr protein kinase family. It contains one protein kinase domain. Transforming growth factor-beta (TGF-beta) shows a variety of biological activities in various organs or cells. Some factors such as Smads (Sma and Mad proteins) and TGF-beta activating kinase 1 have been characterized as signalling molecules downstream of TGF-beta. Several TGF-beta response elements have been identified such as cAMP response element, Smad binding element, and recognition sites for activating protein-1 and stimulating protein-1 in various gene promoters. STK16 / MPSK1 is an unique factor with two biological functions, transcriptional regulation and protein phosphorylation, that may be involved in TGF-beta signals. STK16 / MPSK1 is a protein kinase that act on both serine and threonine residues. STK16 / MPSK1 possessed DNA-binding ability and activated the TGF-beta responsive CNP promoter or vascular endothelial growth factor gene promoter which possesses a sequence element analogous to the TGF-beta responsive GC-rich element of the CNP promoter. STK16 / MPSK1 did not directly activate a Smads-dependent promoter from plasminogen activator inhibitor 1 gene, but it showed enhancement in co-operation with Smad3 and Smad4. STK16 / MPSK1 mRNA as well as its protein level were stimulated by TGF-beta treatment.

References
  • Ligos J.M., et al., 1998, Biochem. Biophys. Res.Commun. 249:380-4.
  • Berson A.E., et al.,1999, Biochem. Biophys. Res. Commun. 259:533-8.
  • Ohta S., et al., 2000, Biochem. J. 350:395-404.
  • Guinea,B. et al., 2006, Exp Cell Res. 312 (2):135-44. 
  • Size / Price
    Catalog: HG12201-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"