Quick Order

Text Size:AAA

Human CR2 / CD21 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CR2cDNA Clone Product Information
cDNA Size:3102
cDNA Description:ORF Clone of Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 DNA.
Gene Synonym:C3DR, CD21, SLEB9, CR2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD21, also known as Complement component (3d / Epstein Barr virus) receptor 2 and CR2, is a member of the CD system and is a protein involved in complement system. CD21 is present on all mature B-cells and some T-cells and follicular dendritic cells. CD21 on mature B-cells form a complex called the B cell receptor complex with two other membrane proteins, CD19 and CD81. CD21 has a function in the complement system through serving as the cellular receper specific for ligands such as C3 and C4 which can be attached to foreign macromolecules in order to remove or uptake them. This results in B-cells having enhanced response to the antigen.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joseph M, et al. (1989) Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21). Advanced in immunology. 46: 183-219.
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature 358: 505 - 7.