Quick Order

Human HRAS Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HRAScDNA Clone Product Information
cDNA Size:570
cDNA Description:ORF Clone of Homo sapiens v-Ha-ras Harvey rat sarcoma viral oncogene homolog DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

HRas, also known as HRAS, belongs to the small GTPase superfamily, Ras family and is widely expressed. It functions in signal transduction pathways. HRas can bind GTP and GDP, and they have intrinsic GTPase activity. It undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Defects in HRAS are the cause of faciocutaneoskeletal syndrome (FCSS). FCSS is arare condition characterized by prenatally increased growth, postnatal growth deficiency, mental retardation, distinctive facial appearance, cardiovascular abnormalities, tumor predisposition, skin and musculoskeletal abnormalities. Defects in HRAS also can cause congenital myopathy with excess of muscle spindles. HRAS deficiency may be a cause of susceptibility to Hurthle cell thyroid carcinoma. It has been shown that defects in HRAS can cause susceptibility to bladder cancer which is a malignancy originating in tissues of the urinary bladder. It often presents with multiple tumors appearing at different times and at different sites in the bladder. Most bladder cancers are transitional cell carcinomas. They begin in cells that normally make up the inner lining of the bladder. Other types of bladder cancer include squamous cell carcinoma (cancer that begins in thin, flat cells) and adenocarcinoma (cancer that begins in cells that make and release mucus and other fluids). Bladder cancer is a complex disorder with both genetic and environmental influences. Defects in HRAS are the cause of oral squamous cell carcinoma.

  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Gripp KW, et al. (2011) Molecular confirmation of HRAS p.G12S in siblings with Costello syndrome. Am J Med Genet A. 155A(9):2263-8.
  • Na KY, et al. (2012) Allelic loss of susceptibility loci and the occurrence of BRAF and RAS mutations in patients with familial non-medullary thyroid cancer. J Surg Oncol. 105(1):10-4.
  • Membrino A, et al. (2011) G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS One. 6(9):e24421.