After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RELA cDNA Clone Product Information
Gene_bank_ref_id:NM_021975
RefSeq ORF Size:1656bp
cDNA Description:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal Myc tag.
Gene Synonym:p65
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-RELA-Myc
Restriction Site:KpnI + XbaI (6kb + 1.71kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-Myc tag on other vectors
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-GFPSpark tagHG12054-ACG$345
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG12054-ACR$345
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-GFPSpark tagHG12054-ANG$345
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG12054-ANR$345
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-Flag tagHG12054-CF$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tagHG12054-CH$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-Myc tagHG12054-CM$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-HA tagHG12054-CY$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA clone plasmidHG12054-G$125
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-Flag tagHG12054-NF$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-His tagHG12054-NH$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-Myc tagHG12054-NM$315
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, N-HA tagHG12054-NY$315
Human RELA / Transcription factor p65 / NFkB p65 natural ORF mammalian expression plasmidHG12054-UT$315
 Learn more about expression Vectors
Product nameProduct name
Background

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catalog: HG12054-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"