After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine IL6 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Canine IL6 cDNA Clone Product Information
NCBI RefSeq:NM_001003301.1
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris interleukin 6 (interferon, beta 2) with C terminal His tag.
Gene Synonym:IL-6, IL6
Species:Canine
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Human Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin ProteinHuman LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Human IL11RA / IL11Rα Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Human CNTF Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat CNTFR / CNTFR-alpha Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat CNTF / Ciliary Neurotrophic Factor ProteinHuman G-CSFR / CD114 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Rhesus IL6 / Interleukin-6 ProteinHuman IL11 / Interleukin 11 / IL-11 ProteinHuman LIF Protein (His Tag)Human LIF Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinCanine IL11RA / IL-11RA / IL11Rα ProteinRat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Mouse LIF ProteinHuman Interleukin-31 receptor A / IL31RA Protein (His Tag)
Background

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

References
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • Size / Price
    Catalog: DG70015-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"