Quick Order

Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK1A1cDNA Clone Product Information
cDNA Size:1014
cDNA Description:ORF Clone of Homo sapiens casein kinase 1, alpha 1 DNA.
Gene Synonym:CK1, HLCDGP1, PRO2975, CSNK1A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10668-ACG$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10668-ACR$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10668-ANG$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10668-ANR$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10668-CF$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10668-CH$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10668-CM$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10668-CY$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone)HG10668-M$95
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10668-M-F$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10668-M-N$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10668-NF$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10668-NH$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10668-NM$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10668-NY$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10668-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items