Quick Order

Human CCL23 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CCL23 cDNA Clone Product Information
NCBI RefSeq:NM_005064.3
RefSeq ORF Size:414bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 23 with N terminal Myc tag.
Gene Synonym:CKb8, MIP3, Ckb-8, MIP-3, MPIF-1, SCYA23, Ckb-8-1, CK-BETA-8
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

CCL23, also known as MIP 3, is a small cytokine which belongs to the CC chemokine family. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. CCL23 is predominantly expressed in lung and liver tissue, but also can be detected in bone marrow and placenta. It displays chemotactic activity on resting T lymphocytes and monocytes, lower activity on neutrophils and no activity on activated T lymphocytes. CCL23 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line.

References
  • Poposki JA. et al., 2011, J Allergy Clin Immunol. 128 (1): 73-81.
  • Matsumoto K. et al., 2011, Int Arch Allergy Immunol. 155 (1): 34-9.
  • Kim CS. et al., 2011, Inflamm Res. 60 (9): 889-95.
  • Size / Price
    Catalog: HG10655-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"