Quick Order

Text Size:AAA

Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDC37cDNA Clone Product Information
cDNA Size:1137
cDNA Description:ORF Clone of Homo sapiens cell division cycle 37 homolog (S. cerevisiae) DNA.
Gene Synonym:P50CDC37
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10647-ACG$325
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10647-ACR$325
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10647-ANG$325
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10647-ANR$325
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10647-CF$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10647-CH$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10647-CM$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10647-CY$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone)HG10647-M$95
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10647-M-F$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10647-M-N$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10647-NF$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10647-NH$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10647-NM$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10647-NY$295
Human CDC37 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10647-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items